bakimliyiz
Sponsor Reklamlar
Geri git   Bakimliyiz.Com > TEKNİK & ELEKTRONİK > Teknoloji

Kadın Portalı Kayıt Ol İletişim Forumları Okundu Kabul Et
Alt 15-09-2011, 03:05   #1 (permalink)
 
mormavi - ait Kullanıcı Resmi (Avatar)
 
Arrow Disk Yerine Bakteri....

Genç araştırmacıların tasarımı bakteriler üzerine veri depolamayı mümkün kılıyor.
Disk Yerine Bakteri....
Tüm bir bilgisayar diskini dolduran bilgiyi DNA dizilimi şekline dönüştürerek E. coli bakterisi içinde saklamak mümkün. Bu tip mikroorganizmalar içinde veri saklama fikri yeni olmasa da ‘Uluslararası Genetik Mühendisliği Ürünü Makine’ yarışmasının 2010 yılı katılımcılarından Hong Kong’lu ekip bunu pratiğe dökebilmiş. En basit bakteriler bile binlerce bazdan meydana gelen uzun DNA zincirlerini barındırabiliyor ve bir sabit diskten çok daha dayanıklılar. Üstelik bakterilerin doğal çoğalma yetenekleri mevcut verinin istenildiği kadar kopyasının alınmasına olanak sağlıyor.

Veriyi bir bakteri içine yerleştirmek için uygulanacak basamaklar oldukça basit. DNA dizilimini oluşturmak için adenin guanin sitozin ve timin adı verilen dört bazdan yararlanılabiliyor. Bu da dört tabanına uyan bir sistemle çalışmak zorundayız anlamına geliyor. Çevirme işlemi ise şöyle yapılıyor:
Örneğin ‘i’ harfini ele alalım. Latin alfabesi üzerine kurulu 7 bitlik bir karakter seti olan ASCII tablosunu kullanarak her harfin rakamsal karşılığını elde edebiliyoruz. Buna göre i harfinin karşılığı 105 oluyor. Bu rakamı da onluk tabandan dörtlük tabana çevirdiğimizde 1221 sayısını elde ediyoruz. Dörtlük sistemde her rakamın karşılığı olan bazlar şöyle: 0=A 1=T 2=C 3=G. 1221 sayısını da bu eşitliğe uyguladığımızda TCCT dizilimi karşımıza çıkıyor. Bu sisteme göre NTV BİLİM kelimelerinin karşılığı olan dizilimse şöyle: ‘TAGCTTTATTTCACAATAACTAGAATAGATAGAATAGT’.



Ham verilerin elde edilmesinden sonra kullanılacak bazı algoritmalarla kıslatmalar yapmak da mümkün. Böylece sadece belirli bir kısaltma yapılmakla kalmayıp canlıya biyolojik açıdan zararlı olabilen fazla sayıdaki tekrarlı dizilerden de kurtulmuş olunuyor. Eğer bir bakteri veriyi depolamak için tek başına yeterli gelmiyorsa bunu parçalara bölmek de olası. Örneğin Amerika’nın Bağımsızlık Bildirgesi’ni sığdırmak için 18 tane E. coli bakterisine ihtiyaç duyuluyor. Ortalama olarak 1 gram ağırlığındaki bakterilerin alacağı veri miktarı ise yaklaşık 900 terabayt.


mormavi isimli Üye şimdilik offline konumundadır  





Hızlı Cevap

Doğrulama Sorusu
Mesajınız:
Yazı şeklini sil
Kalın
Eğik yazı
Altı çizik

Grafik ekle
Alıntı yap [QUOTE]
 
Alanı Küçült
Alanı Büyült

Seçenekler
Stil


Disk Yerine Bakteri....

Disk Yerine Bakteri.... konusu, TEKNİK & ELEKTRONİK / Teknoloji forumunda tartışılıyor.


Konu etiketleri: diş bakterisi,

Benzer Konular

Konu Konuyu Başlatan Forum Cevap Son Mesaj
Diş Fırçalarındaki Ölümcül Bakteri! daywest Ağız, Diş Sağlığı ve Diş Bakımı 0 16-08-2011 11:46
Bakteri elif Eğitim ve Öğretim 0 15-06-2011 05:48
Salmonelloz (Bakteri Zehirlenmesi ) Nedir? - Salmonelloz Hakkında elif Sağlığımız 0 23-04-2011 10:40
Disk fren SÜKÛT Arabalar 0 26-03-2010 01:41

Üye olmadan soru sorabilirsiniz!

Bütün Zaman Ayarları WEZ +4 olarak düzenlenmiştir. Saat şuan 12:22 .


Powered by vBulletin® Version 3.8.7
Copyright ©2000 - 2017, Jelsoft Enterprises Ltd.
SEO by vBSEO 3.5.2 ©2010, Crawlability, Inc.
Web Stats